People Search
Phones, Emails, Addresses, Background check, Web references
All public info
Like other search engines (Google or Bing) Radaris collects information from public sources.
kaiko@katakura.co.jp Copyright(C)2006 KATAKURA Industries Co., Ltd. All right reserved.
Name: Asst Prof. Yeo Kai Kow Joseph PhD, Med., BSc., Dip Ed. (Singapore) Location: Room 7-03-33. Contact (65) 6790 3912. Email: kaikow.yeo@nie.edu.sg
Dismissal and resignation "Dismissal" (kaiko) means a company makes a worker leave. "Resignation" (taishoku) means a worker leaves a company for himself or herself.
<Primer Sequence > 1.For pM vectors pM forward ⋯ 5'‑aaccatctcgcaaataaata‑3' pM reverse ⋯ 5'‑cgcacagaatctaacgctta‑3' 2.For pV vectors pV forward ⋯ 5 ...
Ko-Bun Kai is an association of the alumni of both the Faculty of Humanities and of the Faculty of Literature and Science of former days (1949-1978).
Secretary Mr.Yuan-Kai Ko Department of Computer Science and Information Engineering, National Taiwan University of Science and Technology,
Name: Asst Prof. Yeo Kai Kow Joseph PhD, Med., BSc., Dip Ed. (Singapore) Location: Room 7-03-33. Contact (65) 6790 3912. Email: kaikow.yeo@nie.edu.sg
kaikokatakura.co.jp Copyright(C)2006 KATAKURA Industries Co., Ltd. All right reserved.
Linkedin
Honeywell Pte Ltd (Public Company; HON; Industrial Automation industry): System Engineer, (February 1992-June 2006)
Honeywell Pte Ltd (Public Company; HON; Industrial Automation industry): System Engineer, (February 1992-June 2006)