Md Myb

Like other search engines (Google or Bing) Radaris collects information from public sources.

Social Networks featuring Md Myb

Linkedin

   
md yunus burhanek myb

Locality: Malaysia
Summary: civil & structural at action base consultants sdn bhd
Industry: Civil Engineering
Experience: action base consultants sdn bhd (Civil Engineering industry): civil & structural,   

Interests: career opportunities, consulting offers, new ventures, job inquiries, expertise requests, business deals, reference requests, getting back in touch

References for Md Myb

Web Results

CiNii Article - 1P580 Dynamics of cavity in c-Myb R2 ...

1P580 Dynamics of cavity in c-Myb R2 sub-domain studied by high-pressure MD simulation(27. Molecular dynamics simulation,Poster Session,Abstract,Meeting Program of EABS ...

PS50090

ma /default: d=-20; i=-20; b1=-40; e1=-40; mi=-105; md=-105; im=-105; dm=-105; ma ... hofmann; cc /taxo-range=??epv; /max-repeat=4; cc /ft_key=dna_bind; /ft_desc=myb ...

Board of Trustees

Mr. Habib Ur Rehman Khan Managing Director OPF 051-9219119 md@opf ... Muhammad Yar Bhuttor Executive Director Finance OPF 051-9210264 myb@opf.org.pk

NMJ

the guanidine thiocyanate procedure using TRIzol TM Reagent (GIBCO BRL, MD, USA). ... primer, TTGGAAGAGGCAGGAAAGCAG; 3' primer, GATTGGAGGTGGTAAAGGTGTT), for human c-Myb (5 ...

Structure of MYB Family

McIntosh PB, Frenkiel TA, Wollborn U, McCormick JE, Klempnauer KH, Feeney J, Carr MD. Solution structure of the B-Myb DNA-binding domain: a possible role for ...

Overseas Pakistanis Foundation

MD's SECRETARIAT: HABIB UR REHMAN KHAN: Managing Director ... myb@opf.org.pk: FAHEEM ATHAR: GM : 419: 9208288 : SYED KAMAL AHMED: A/GM: 431: 9207102 : FINANCE SECTION

International Affairs Division

Dr. Mohd. Hizamri bin Md Yasin: Penolong Pengarah Kanan: hizamri: 588: En. Mohd Yusoff bin Baharom: Penolong Pengarah : myb: 522: Pn. Siti Dessyma bt Isnani

Graduate School of Comprehensive Human Sciences-Majors of ...

Kanei-Ishii C et al. Wnt-1 signal induces phosphorylation and degradation of c-Myb protein via TAK1, HIPK2, and NLK. Genes Dev. 2004; 18: 816-829.

In this web site, the author (M

First of all, molecular dynamics simulations are performed for the protein. ... A wild type protein (Myb R2) is prepared using NMR structure (1MBG) as an ...

Graduate School of Comprehensive Human Sciences-Majors of ...

Nomura T, et al. Oncogenic activation of c-Myb correlates with a loss of negative regulation by TIF1 and Ski. J. Biol. Chem. 2004;279:16715-16726